Abstract
Entamoeba histolytica has a central place in the intestinal protozoa, and its impact is both within the field of veterinary medicine and a possible impact of its ramifications on the populace. During this investigation, it was attempted to establish its prevalence in the faecal samples of sheep of the Al-Basra Province. Using the molecular techniques, to gain an in-depth insight into its prevalence in this stock. In the study we, a total of sixty-five faecal samples of the sheep were collected, separated the DNA and carried out polymerase-chain-reaction (PCR) against the small-subunit ribosomal RNA (SSU rRNA) gene by using the F: TCAGACGAAAGTCGGAGGTT and R: AGACAAATCGCTCCACCAAC primers. PCR protocol was a 20 1 mixture with AccuPower 1 PCR PreMix, cycled at 95 °C 5 min; 30 cycles 95 o C/30 s, 52 o C/30 s, 72 o C/30 s, and a final extension of 72 o C/10 M. PCR products were resolved on a 1.5 per cent agarose gel and stained and viewed under UV light. Out of the PCR-positive samples, four purified amplicons were sequenced partially and the sequences were uploaded to GenBank (accession numbers OR787535.1 to OR787538.1). Phylogenetic analyses using the neighbour-joining method was estimated was able to amplify a fragment of about 338 bps corresponding the SSU rRNA gene in all positive samples that bore as discrete and single bands on the agarose and gel. The four sequenced isolates, EH -H1 to EH -H4, fell squarely within the E. histolytica clade in the phylogenetic tree. Their closest neighbors were reference strains of Iraq, namely, OQ504208.1 and OQ504207.1 that showed a high genetic affiliation. Internal node bootstrap of these isolates was 39 to 47 %, a low value which indicates little discrimination on fine-scale branching but still a strong affirmation of species

Key words: Entamoeba histolytica, sheep, SSU rRNA, PCR, sequencing.